Review



web-based guide rna (grna) design tool  (ATUM Bio)


Bioz Verified Symbol ATUM Bio is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATUM Bio web-based guide rna (grna) design tool
    Web Based Guide Rna (Grna) Design Tool, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/web-based+guide+rna+(grna)+design+tool/web+based+guide+rna++grna++design+tool/pmc06517599-450-2-9
    Average 90 stars, based on 1 article reviews
    web-based guide rna (grna) design tool - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: GP78 Cooperates with Dual-Specificity Phosphatase 1 To Stimulate Epidermal Growth Factor Receptor-Mediated Extracellular Signal-Regulated Kinase Signaling
    Article Snippet: A Web-based Atum guide RNA (gRNA) design tool ( https://www.atum.bio ) was used to design gRNA, and CACGGCTGCTTAAGCTGCAACGTGGAGTA was used to target exon 6 of GP78.

    Article Title: GP78 Cooperates with Dual-Specificity Phosphatase 1 To Stimulate Epidermal Growth Factor Receptor-Mediated Extracellular Signal-Regulated Kinase Signaling
    Article Snippet: A web-based ATUM 446 gRNA Design Tool (https://www.atum.bio) was used to design gRNA, and 447 CACGGCTGCTTAAGCTGCAACGTGGAGTA was used to target the exon 6 of GP78.



    Similar Products

    90
    ATUM Bio web-based guide rna (grna) design tool
    Web Based Guide Rna (Grna) Design Tool, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/web-based+guide+rna+(grna)+design+tool/web+based+guide+rna++grna++design+tool/pmc06517599-450-2-9
    Average 90 stars, based on 1 article reviews
    web-based guide rna (grna) design tool - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results